circad | circRNAs associated with diseases

hsa_circ_0001895/circPRRC2B/hsa_circ_000760
Gene	PRRC2B	Organism	Human
Genome Locus	chr9:134305476-134308181:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28443463
Experimental Method
Sample Type	Tissues	Comparison	96 gastric cancer tissues and their adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCAAACAAGCAGGATCAGCAA Reverse CCCATCCTTGCCCTTGGTAA	Statistics	Fold Change : Downregulated pvalue : p<0.001
Citation
Shao, Y, Chen, L, Lu, R, Zhang, X, Xiao, B, Ye, G, Guo, J (2017). Decreased expression of hsa_circ_0001895 in human gastric cancer and its clinical significances. Tumour Biol., 39, 4:1010428317699125.